|
-
PL/SQL procedures and functions
sir,
i have 3 doubts regarding pl/sql procedures. i will be ever greatful to you if you clarify my doubts .
--------------------------------------------------------------------
First 1 is: How can I find charecters presented in a DNAsequence (column name) inserted in a table(varchar2 or long )(A,T's) using PL/SQL sub programme?
i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data)
In this sequence to find out how many A,G,T,Cs are present.
----------------------------------------------------------------------
Second 1 is: how can i find the size of a DNA sequence, inserted in a table, using PL/SQL function (without using Length() function)?
i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data)
In this sequence to find out total length of the sequence without using the Length() function.
----------------------------------------------------------------------
Thrid 1 is: How can i find total number of charecters in a DNA sequence, inserted in a table, using PL/SQL Trigger?
i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data). In this sequence to find out the total number of characters(A,G,T,Cs) are present or number of characters in the sequence.
---------------------------------------------------------------------
please clarify my doubts .
waiting for yur reply...
thanking yu,
yur faithfully,
Bala prasad
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|
Click Here to Expand Forum to Full Width
|