DBAsupport.com Forums - Powered by vBulletin
Results 1 to 4 of 4
  1. #1
    Join Date
    Sep 2003

    PL/SQL procedures and functions


    i have 3 doubts regarding pl/sql procedures. i will be ever greatful to you if you clarify my doubts .

    First 1 is: How can I find charecters presented in a DNAsequence (column name) inserted in a table(varchar2 or long )(A,T's) using PL/SQL sub programme?

    i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data)
    In this sequence to find out how many A,G,T,Cs are present.

    Second 1 is: how can i find the size of a DNA sequence, inserted in a table, using PL/SQL function (without using Length() function)?

    i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data)
    In this sequence to find out total length of the sequence without using the Length() function.
    Thrid 1 is: How can i find total number of charecters in a DNA sequence, inserted in a table, using PL/SQL Trigger?

    i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data). In this sequence to find out the total number of characters(A,G,T,Cs) are present or number of characters in the sequence.


    please clarify my doubts .

    waiting for yur reply...

    thanking yu,

    yur faithfully,

    Bala prasad

  2. #2
    Join Date
    Dec 2001

    First off, don't use LONG datatypes. They suck big-time. Use CLOBs instead and like will be good

    1) You could do something like one of these two examples (both using LONGs in 9i):

    CREATE TABLE test1 (col1 LONG);

    l_seq LONG;
    l_a NUMBER := 0;
    l_t NUMBER := 0;
    l_c NUMBER := 0;
    l_g NUMBER := 0;
    SELECT col1
    INTO l_seq
    FROM test1
    WHERE rownum =1;

    l_a := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(l_seq, 'T', ''), 'C', ''), 'G', '')));
    l_t := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(l_seq, 'A', ''), 'C', ''), 'G', '')));
    l_c := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(l_seq, 'A', ''), 'T', ''), 'G', '')));
    l_g := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(l_seq, 'A', ''), 'T', ''), 'C', '')));

    DBMS_OUTPUT.put_line('A:' || l_a || ' T:' || l_t || ' C:' || l_c || ' G:' || l_g);

    l_seq LONG;
    l_a NUMBER := 0;
    l_t NUMBER := 0;
    l_c NUMBER := 0;
    l_g NUMBER := 0;
    SELECT col1
    INTO l_seq
    FROM test1
    WHERE rownum =1;

    FOR i IN 1 .. LENGTH(l_seq) LOOP
    CASE SUBSTR(l_seq, i, 1)
    WHEN 'A' THEN l_a := l_a + 1;
    WHEN 'T' THEN l_t := l_t + 1;
    WHEN 'C' THEN l_c := l_c + 1;
    WHEN 'G' THEN l_g := l_g + 1;

    DBMS_OUTPUT.put_line('A:' || l_a || ' T:' || l_t || ' C:' || l_c || ' G:' || l_g);

    2) What's the reason for not using the LENGTH function? That's what it's for!

    3) You can't reference a LONG in a trigger so you can only do this with a VARCHAR2 or a CLOB. Here's an example with a CLOB:

    DROP TABLE test1;
    CREATE TABLE test1 (col1 CLOB);

    l_a NUMBER := 0;
    l_t NUMBER := 0;
    l_c NUMBER := 0;
    l_g NUMBER := 0;
    l_a := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(:new.col1, 'T', ''), 'C', ''), 'G', '')));
    l_t := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(:new.col1, 'A', ''), 'C', ''), 'G', '')));
    l_c := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(:new.col1, 'A', ''), 'T', ''), 'G', '')));
    l_g := TO_NUMBER(LENGTH(REPLACE(REPLACE(REPLACE(:new.col1, 'A', ''), 'T', ''), 'C', '')));

    DBMS_OUTPUT.put_line('A:' || l_a || ' T:' || l_t || ' C:' || l_c || ' G:' || l_g);


    Remember, it's always better to put code into packaged procedures and call them from triggers rather than putting the codein a trigger directly.

    OCP DBA 7.3, 8, 8i, 9i, 10g, 11g
    OCA PL/SQL Developer
    Oracle ACE Director
    My website: oracle-base.com
    My blog: oracle-base.com/blog

  3. #3
    Join Date
    Dec 2001
    Bye the way, I did my PhD in Molecular Genetics. This takes me back a bit
    OCP DBA 7.3, 8, 8i, 9i, 10g, 11g
    OCA PL/SQL Developer
    Oracle ACE Director
    My website: oracle-base.com
    My blog: oracle-base.com/blog

  4. #4
    Join Date
    Aug 2002
    Colorado Springs
    Originally posted by TimHall
    Remember, it's always better to put code into packaged procedures and call them from triggers rather than putting the codein a trigger directly.
    And better then PL/SQL is to use SQL functions -- you avoid a costly context switch by doing so.
    David Aldridge,
    "The Oracle Sponge"

    Senior Manager, Business Intelligence Development
    XM Satellite Radio
    Washington, DC

    Oracle ACE

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts

Click Here to Expand Forum to Full Width