Click to See Complete Forum and Search --> : PL/SQL functions and procedures


balabioinfo
09-18-2003, 02:00 AM
sir,

i have 3 doubts regarding pl/sql procedures. i will be ever greatful to you if you clarify my doubts .
--------------------------------------------------------------------

First 1 is: How can I find charecters presented in a DNAsequence (column name) inserted in a table(varchar2 or long )(A,T's) using PL/SQL sub programme?

i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data)
In this sequence to find out how many A,G,T,Cs are present.
----------------------------------------------------------------------

Second 1 is: how can i find the size of a DNA sequence, inserted in a table, using PL/SQL function (without using Length() function)?

i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data)
In this sequence to find out total length of the sequence without using the Length() function.
----------------------------------------------------------------------
Thrid 1 is: How can i find total number of charecters in a DNA sequence, inserted in a table, using PL/SQL Trigger?

i.e Suppose a sequence is like this : ATTCACGTAGGCGATCACTGTAC etc. (column data). In this sequence to find out the total number of characters(A,G,T,Cs) are present or number of characters in the sequence.

---------------------------------------------------------------------

please clarify my doubts .

waiting for yur reply...

thanking yu,

yur faithfully,

Bala prasad